Review



wisp-1 trilencer-27 rat sirna sr509133  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    OriGene wisp-1 trilencer-27 rat sirna sr509133
    Wisp 1 Trilencer 27 Rat Sirna Sr509133, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wisp+1+sirnas/wisp+1+plasmid/pm31512238-45-4-10
    Average 90 stars, based on 1 article reviews
    wisp-1 trilencer-27 rat sirna sr509133 - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: Macrophage-derived IL-10 mediates mucosal repair by epithelial WISP-1 signaling
    Article Snippet: Proliferating cells were detected with the Click-iT EdU Alexa Fluor 488 Imaging Kit (Life Sciences, Thermo Fisher Scientific; catalog {"type":"entrez-nucleotide","attrs":{"text":"C10637","term_id":"1535708","term_text":"C10637"}} C10637 ) using a Leica SP5 confocal microscope (Leica Microsystems). siRNAs. .. WISP-1 siRNAs (no. 1: GGAGUUUGCAUGGACAAUAGGUGCT; no. 2: ACAUCCAUACACUCAUUAAGGCAGG; no. 3: AGACUAUCGACGUGUCCUUCCAGTG) were purchased from OriGene (catalog SR305836), and IL-10Rα and IL-10β siRNAs (SMARTpool, catalog L-007925-00-0005) were purchased from GE Dharmacon and used for transfection studies with Lipofectamine 2000 (Life Technologies, Thermo Fisher Scientific) according to the manufacturers’ instructions. .. Transfection of nonsilencing siRNA (Sigma-Aldrich; catalog SIC002) was used as a negative control.



    Similar Products

    86
    Bioneer Corporation sirnas targeting wisp 1
    Sirnas Targeting Wisp 1, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wisp+1+sirnas/independent+lgals3bp+sirnas+targeting/pmc12781172-95-8-11
    Average 86 stars, based on 1 article reviews
    sirnas targeting wisp 1 - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology antibodies ankfy1
    Antibodies Ankfy1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wisp+1+sirnas/WISP-1+siRNA/10__1096_slash_fj__202402274r-95-0-6
    Average 93 stars, based on 1 article reviews
    antibodies ankfy1 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Bioneer Corporation sirna targeting wisp-1
    Sirna Targeting Wisp 1, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wisp+1+sirnas/wisp+1+specific+small+interfering++si+rna/pmc11837402-78-10-13
    Average 90 stars, based on 1 article reviews
    sirna targeting wisp-1 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology gdf15 shrna lentiviral transduction particles
    Gdf15 Shrna Lentiviral Transduction Particles, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wisp+1+sirnas/WISP-1+siRNA/pm39804805-59-1-7
    Average 93 stars, based on 1 article reviews
    gdf15 shrna lentiviral transduction particles - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology atf3 shrna lentiviral transduction particles
    <t>ATF3</t> is predicted as a favorable prognostic factor and is positively associated with GDF15 in bladder cancer. (A) Data of TCGA gained from the GEPIA database showed ATF3 expression levels across 31 kinds of tumor samples and paired normal tissues. The bar height represents the median expression of ATF3 in certain tumor types or normal tissues, as indicated. (B) Expression levels of ATF3 in the TCGA database from 28 normal and 404 tumor groups, respectively. (C) Correlation between ATF3 expression levels and progression-free survival (P.F.S.) of bladder urothelial carcinoma patients generated from TCGA-BLCA database. (D) The co-expression of ATF3 with GDF15 in TCGA-BLCA database. (E) Kaplan-Meier analysis of progression-free survival of TCGA-BLCA database, comparing subsets with double high expressions of ATF3 and GDF15 to those with double low expressions. Abbreviation: ACC: adrenocortical carcinoma; BLCA: bladder urothelial carcinoma; BRCA: breast invasive carcinoma; CESC: cervical squamous cell carcinoma and endocervical adenocarcinoma; CHOL: cholangiocarcinoma; COAD: colon adenocarcinoma; DLBC: lymphoid neoplasm diffuse large B-cell lymphoma; ESCA: esophageal carcinoma; GBM: glioblastoma multiforme; HNSC: head and neck squamous cell carcinoma; KICH: kidney chromophobe; KIRC: kidney renal clear cell carcinoma; KIRP: kidney renal papillary cell carcinoma; LAML: acute myeloid leukemia; BLGG: brain lower grade glioma; LIHC: liver hepatocellular carcinoma; LUAD: lung adenocarcinoma; LUSC: lung squamous cell carcinoma; OV: ovarian serous cystadenocarcinoma; PAAD: pancreatic adenocarcinoma; PCPG: pheochromocytoma and paraganglioma; PRAD: prostate adenocarcinoma; READ: rectum adenocarcinoma; SARC: sarcoma; SKCM: skin cutaneous melanoma; STAD: stomach adenocarcinoma; TGCT: testicular germ cell tumors; THCA: thyroid carcinoma; THYM: thymoma; UCEC: uterine corpus endometrial carcinoma; and UCS: uterine carcinosarcoma. ∗, p < 0.05.
    Atf3 Shrna Lentiviral Transduction Particles, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wisp+1+sirnas/WISP-1+siRNA/pmc12008522-47-2-13
    Average 93 stars, based on 1 article reviews
    atf3 shrna lentiviral transduction particles - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology anti slmap
    <t>ATF3</t> is predicted as a favorable prognostic factor and is positively associated with GDF15 in bladder cancer. (A) Data of TCGA gained from the GEPIA database showed ATF3 expression levels across 31 kinds of tumor samples and paired normal tissues. The bar height represents the median expression of ATF3 in certain tumor types or normal tissues, as indicated. (B) Expression levels of ATF3 in the TCGA database from 28 normal and 404 tumor groups, respectively. (C) Correlation between ATF3 expression levels and progression-free survival (P.F.S.) of bladder urothelial carcinoma patients generated from TCGA-BLCA database. (D) The co-expression of ATF3 with GDF15 in TCGA-BLCA database. (E) Kaplan-Meier analysis of progression-free survival of TCGA-BLCA database, comparing subsets with double high expressions of ATF3 and GDF15 to those with double low expressions. Abbreviation: ACC: adrenocortical carcinoma; BLCA: bladder urothelial carcinoma; BRCA: breast invasive carcinoma; CESC: cervical squamous cell carcinoma and endocervical adenocarcinoma; CHOL: cholangiocarcinoma; COAD: colon adenocarcinoma; DLBC: lymphoid neoplasm diffuse large B-cell lymphoma; ESCA: esophageal carcinoma; GBM: glioblastoma multiforme; HNSC: head and neck squamous cell carcinoma; KICH: kidney chromophobe; KIRC: kidney renal clear cell carcinoma; KIRP: kidney renal papillary cell carcinoma; LAML: acute myeloid leukemia; BLGG: brain lower grade glioma; LIHC: liver hepatocellular carcinoma; LUAD: lung adenocarcinoma; LUSC: lung squamous cell carcinoma; OV: ovarian serous cystadenocarcinoma; PAAD: pancreatic adenocarcinoma; PCPG: pheochromocytoma and paraganglioma; PRAD: prostate adenocarcinoma; READ: rectum adenocarcinoma; SARC: sarcoma; SKCM: skin cutaneous melanoma; STAD: stomach adenocarcinoma; TGCT: testicular germ cell tumors; THCA: thyroid carcinoma; THYM: thymoma; UCEC: uterine corpus endometrial carcinoma; and UCS: uterine carcinosarcoma. ∗, p < 0.05.
    Anti Slmap, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wisp+1+sirnas/WISP-1+siRNA/pm36115593-54-119-123
    Average 93 stars, based on 1 article reviews
    anti slmap - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology sirna targeting wisp1
    Figure 1. Expression of <t>WISP1</t> in LSCC tissues. The mRNA (a) and protein (b) levels of WISP1 in normal mucosa and LSCC tissues were determined by qRT-PCR and Western blotting. The transcription (c) and protein (d) expression of WISP1 in LSCC with metastasis and without metastasis groups. *P < 0.05.
    Sirna Targeting Wisp1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wisp+1+sirnas/WISP-1+siRNA/pm33593111-63-2-17
    Average 93 stars, based on 1 article reviews
    sirna targeting wisp1 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    OriGene wisp-1 trilencer-27 rat sirna sr509133
    Figure 1. Expression of <t>WISP1</t> in LSCC tissues. The mRNA (a) and protein (b) levels of WISP1 in normal mucosa and LSCC tissues were determined by qRT-PCR and Western blotting. The transcription (c) and protein (d) expression of WISP1 in LSCC with metastasis and without metastasis groups. *P < 0.05.
    Wisp 1 Trilencer 27 Rat Sirna Sr509133, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wisp+1+sirnas/wisp+1+plasmid/pm31512238-45-4-10
    Average 90 stars, based on 1 article reviews
    wisp-1 trilencer-27 rat sirna sr509133 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Qiagen silencing rnas (sirnas) for wisp-1 s100212702 and s102673370
    Figure 1. Expression of <t>WISP1</t> in LSCC tissues. The mRNA (a) and protein (b) levels of WISP1 in normal mucosa and LSCC tissues were determined by qRT-PCR and Western blotting. The transcription (c) and protein (d) expression of WISP1 in LSCC with metastasis and without metastasis groups. *P < 0.05.
    Silencing Rnas (Sirnas) For Wisp 1 S100212702 And S102673370, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wisp+1+sirnas/silencing+rna+wisp+1++ms+/pmc06351844-137-8-21
    Average 90 stars, based on 1 article reviews
    silencing rnas (sirnas) for wisp-1 s100212702 and s102673370 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    ATF3 is predicted as a favorable prognostic factor and is positively associated with GDF15 in bladder cancer. (A) Data of TCGA gained from the GEPIA database showed ATF3 expression levels across 31 kinds of tumor samples and paired normal tissues. The bar height represents the median expression of ATF3 in certain tumor types or normal tissues, as indicated. (B) Expression levels of ATF3 in the TCGA database from 28 normal and 404 tumor groups, respectively. (C) Correlation between ATF3 expression levels and progression-free survival (P.F.S.) of bladder urothelial carcinoma patients generated from TCGA-BLCA database. (D) The co-expression of ATF3 with GDF15 in TCGA-BLCA database. (E) Kaplan-Meier analysis of progression-free survival of TCGA-BLCA database, comparing subsets with double high expressions of ATF3 and GDF15 to those with double low expressions. Abbreviation: ACC: adrenocortical carcinoma; BLCA: bladder urothelial carcinoma; BRCA: breast invasive carcinoma; CESC: cervical squamous cell carcinoma and endocervical adenocarcinoma; CHOL: cholangiocarcinoma; COAD: colon adenocarcinoma; DLBC: lymphoid neoplasm diffuse large B-cell lymphoma; ESCA: esophageal carcinoma; GBM: glioblastoma multiforme; HNSC: head and neck squamous cell carcinoma; KICH: kidney chromophobe; KIRC: kidney renal clear cell carcinoma; KIRP: kidney renal papillary cell carcinoma; LAML: acute myeloid leukemia; BLGG: brain lower grade glioma; LIHC: liver hepatocellular carcinoma; LUAD: lung adenocarcinoma; LUSC: lung squamous cell carcinoma; OV: ovarian serous cystadenocarcinoma; PAAD: pancreatic adenocarcinoma; PCPG: pheochromocytoma and paraganglioma; PRAD: prostate adenocarcinoma; READ: rectum adenocarcinoma; SARC: sarcoma; SKCM: skin cutaneous melanoma; STAD: stomach adenocarcinoma; TGCT: testicular germ cell tumors; THCA: thyroid carcinoma; THYM: thymoma; UCEC: uterine corpus endometrial carcinoma; and UCS: uterine carcinosarcoma. ∗, p < 0.05.

    Journal: Biomedical Journal

    Article Title: Activating transcription factor 3 is an antitumor gene synergizing with growth differentiation factor 15 to modulate cell growth in human bladder cancer

    doi: 10.1016/j.bj.2024.100756

    Figure Lengend Snippet: ATF3 is predicted as a favorable prognostic factor and is positively associated with GDF15 in bladder cancer. (A) Data of TCGA gained from the GEPIA database showed ATF3 expression levels across 31 kinds of tumor samples and paired normal tissues. The bar height represents the median expression of ATF3 in certain tumor types or normal tissues, as indicated. (B) Expression levels of ATF3 in the TCGA database from 28 normal and 404 tumor groups, respectively. (C) Correlation between ATF3 expression levels and progression-free survival (P.F.S.) of bladder urothelial carcinoma patients generated from TCGA-BLCA database. (D) The co-expression of ATF3 with GDF15 in TCGA-BLCA database. (E) Kaplan-Meier analysis of progression-free survival of TCGA-BLCA database, comparing subsets with double high expressions of ATF3 and GDF15 to those with double low expressions. Abbreviation: ACC: adrenocortical carcinoma; BLCA: bladder urothelial carcinoma; BRCA: breast invasive carcinoma; CESC: cervical squamous cell carcinoma and endocervical adenocarcinoma; CHOL: cholangiocarcinoma; COAD: colon adenocarcinoma; DLBC: lymphoid neoplasm diffuse large B-cell lymphoma; ESCA: esophageal carcinoma; GBM: glioblastoma multiforme; HNSC: head and neck squamous cell carcinoma; KICH: kidney chromophobe; KIRC: kidney renal clear cell carcinoma; KIRP: kidney renal papillary cell carcinoma; LAML: acute myeloid leukemia; BLGG: brain lower grade glioma; LIHC: liver hepatocellular carcinoma; LUAD: lung adenocarcinoma; LUSC: lung squamous cell carcinoma; OV: ovarian serous cystadenocarcinoma; PAAD: pancreatic adenocarcinoma; PCPG: pheochromocytoma and paraganglioma; PRAD: prostate adenocarcinoma; READ: rectum adenocarcinoma; SARC: sarcoma; SKCM: skin cutaneous melanoma; STAD: stomach adenocarcinoma; TGCT: testicular germ cell tumors; THCA: thyroid carcinoma; THYM: thymoma; UCEC: uterine corpus endometrial carcinoma; and UCS: uterine carcinosarcoma. ∗, p < 0.05.

    Article Snippet: GDF15 and ATF3 shRNA lentiviral transduction particles (sc-39335-V and sc-29757-V) were purchased from Santa Cruz Biotechnology (CA, USA).

    Techniques: Expressing, Generated

    Univariate and multivariate Cox regression analysis of prognostic factors and  ATF3  RNA expression in bladder cancer (N = 169).

    Journal: Biomedical Journal

    Article Title: Activating transcription factor 3 is an antitumor gene synergizing with growth differentiation factor 15 to modulate cell growth in human bladder cancer

    doi: 10.1016/j.bj.2024.100756

    Figure Lengend Snippet: Univariate and multivariate Cox regression analysis of prognostic factors and ATF3 RNA expression in bladder cancer (N = 169).

    Article Snippet: GDF15 and ATF3 shRNA lentiviral transduction particles (sc-39335-V and sc-29757-V) were purchased from Santa Cruz Biotechnology (CA, USA).

    Techniques: RNA Expression, Biomarker Discovery, Expressing

    Univariate and multivariate Cox regression analysis of prognostic factors and  GDF15/ATF3  RNA expression in bladder cancer (N = 89).

    Journal: Biomedical Journal

    Article Title: Activating transcription factor 3 is an antitumor gene synergizing with growth differentiation factor 15 to modulate cell growth in human bladder cancer

    doi: 10.1016/j.bj.2024.100756

    Figure Lengend Snippet: Univariate and multivariate Cox regression analysis of prognostic factors and GDF15/ATF3 RNA expression in bladder cancer (N = 89).

    Article Snippet: GDF15 and ATF3 shRNA lentiviral transduction particles (sc-39335-V and sc-29757-V) were purchased from Santa Cruz Biotechnology (CA, USA).

    Techniques: RNA Expression, Biomarker Discovery, Expressing

    Modulation of ATF3 on cell growth and gene expression in bladder cancer cells. (A, left) The expressions of ATF3, GDF15, NDRG1, KAI-1, and β-actin of ectopic ATF3-overexpressed T24 (T24-ATF3) and mock-overexpressed T24 (T24-DNA) cells were determined by immunoblot assays. (A, right) Quantitative analysis data were expressed as the intensity of protein bands produced from the expressions of the target proteins/β-actin relative to the mock-control group (±SE; n = 3). Cell growth rate of T24-DNA and T24-ATF3 cells was determined by (B) Ki67 or (C) colony formation assays ( n = 3). (D, top) The expressions of ATF3, GDF15, NDRG1, KAI-1, and β-actin of ATF3-knockdown (HT_shATF3) or mock-knockdown (HT_shCOL) HT1376 cells were determined by immunoblot assays. (D, bottom) Quantitative analysis data were expressed as the intensity of protein bands produced from the expressions of the target proteins/β-actin relative to the mock-control group (±SE; n = 3). (E) The mRNA ratio of ATF3, GDF15, NDRG1, and KAI-1 between HT_shATF3 and HT_shCOL cells was determined by RT-qPCR. (F) The reporter activities of GDF15, NDRG1, and KAI-1 reporter vectors after transient overexpression of various dosages of the ATF3 expression vector, as indicated, were determined by reporter assays ( n = 6). (G) Cell growth rate following ATF3 knockdown was determined by Ki67 proliferation assays ( n = 3). ∗, p < 0.05; ∗∗, p < 0.01.

    Journal: Biomedical Journal

    Article Title: Activating transcription factor 3 is an antitumor gene synergizing with growth differentiation factor 15 to modulate cell growth in human bladder cancer

    doi: 10.1016/j.bj.2024.100756

    Figure Lengend Snippet: Modulation of ATF3 on cell growth and gene expression in bladder cancer cells. (A, left) The expressions of ATF3, GDF15, NDRG1, KAI-1, and β-actin of ectopic ATF3-overexpressed T24 (T24-ATF3) and mock-overexpressed T24 (T24-DNA) cells were determined by immunoblot assays. (A, right) Quantitative analysis data were expressed as the intensity of protein bands produced from the expressions of the target proteins/β-actin relative to the mock-control group (±SE; n = 3). Cell growth rate of T24-DNA and T24-ATF3 cells was determined by (B) Ki67 or (C) colony formation assays ( n = 3). (D, top) The expressions of ATF3, GDF15, NDRG1, KAI-1, and β-actin of ATF3-knockdown (HT_shATF3) or mock-knockdown (HT_shCOL) HT1376 cells were determined by immunoblot assays. (D, bottom) Quantitative analysis data were expressed as the intensity of protein bands produced from the expressions of the target proteins/β-actin relative to the mock-control group (±SE; n = 3). (E) The mRNA ratio of ATF3, GDF15, NDRG1, and KAI-1 between HT_shATF3 and HT_shCOL cells was determined by RT-qPCR. (F) The reporter activities of GDF15, NDRG1, and KAI-1 reporter vectors after transient overexpression of various dosages of the ATF3 expression vector, as indicated, were determined by reporter assays ( n = 6). (G) Cell growth rate following ATF3 knockdown was determined by Ki67 proliferation assays ( n = 3). ∗, p < 0.05; ∗∗, p < 0.01.

    Article Snippet: GDF15 and ATF3 shRNA lentiviral transduction particles (sc-39335-V and sc-29757-V) were purchased from Santa Cruz Biotechnology (CA, USA).

    Techniques: Gene Expression, Western Blot, Produced, Control, Knockdown, Quantitative RT-PCR, Over Expression, Expressing, Plasmid Preparation

    Modulation of ATF3 on cell invasion and epithelial-to-mesenchymal transition. The invasion ability of (A) T24-DNA, T24-ATF3, (B) HT_shCOL, and HT_shATF3 cells was determined by Matrigel invasion assays. The quantitative analysis data were expressed as average cell counts/9 fields ± SE. (C) The expressions of N-cadherin, E-cadherin, Snail, Slug, and β-actin in HT_shCOL and HT_shATF3 cells were determined by immunoblot assays. (D) Quantitative analysis data were expressed as the intensity of protein bands produced from the expressions of the target proteins/β-actin relative to the mock-control (HT_shCOL) group (±SE; n = 3). (E) The F-actin staining with Texas Red X-Phalloidin and the fluorescence were recorded using a confocal microscope. (F) The intensities were measured along the line from the peripheral to the central area of the cells, and the quantitative analysis (G) of the F-actin fluorescence intensity of HT_shCOL and HT_shATF3 cells (±SE, n = 4). ∗∗, p < 0.01.

    Journal: Biomedical Journal

    Article Title: Activating transcription factor 3 is an antitumor gene synergizing with growth differentiation factor 15 to modulate cell growth in human bladder cancer

    doi: 10.1016/j.bj.2024.100756

    Figure Lengend Snippet: Modulation of ATF3 on cell invasion and epithelial-to-mesenchymal transition. The invasion ability of (A) T24-DNA, T24-ATF3, (B) HT_shCOL, and HT_shATF3 cells was determined by Matrigel invasion assays. The quantitative analysis data were expressed as average cell counts/9 fields ± SE. (C) The expressions of N-cadherin, E-cadherin, Snail, Slug, and β-actin in HT_shCOL and HT_shATF3 cells were determined by immunoblot assays. (D) Quantitative analysis data were expressed as the intensity of protein bands produced from the expressions of the target proteins/β-actin relative to the mock-control (HT_shCOL) group (±SE; n = 3). (E) The F-actin staining with Texas Red X-Phalloidin and the fluorescence were recorded using a confocal microscope. (F) The intensities were measured along the line from the peripheral to the central area of the cells, and the quantitative analysis (G) of the F-actin fluorescence intensity of HT_shCOL and HT_shATF3 cells (±SE, n = 4). ∗∗, p < 0.01.

    Article Snippet: GDF15 and ATF3 shRNA lentiviral transduction particles (sc-39335-V and sc-29757-V) were purchased from Santa Cruz Biotechnology (CA, USA).

    Techniques: Western Blot, Produced, Control, Staining, Fluorescence, Microscopy

    Modulation of ATF3 on tumor growth of bladder cancer cells in xenograft model. (A) HT_shCOL and HT_shATF3 cells were injected subcutaneously in the dorsal area of the four-week-old male athymic nude mice (n = 8). Tumors derived from both cells were recorded after the mice were sacrificed. The tumor growth rates (B) and animal body weights (C) were measured within 24 days. (D) The tumor weights were recorded immediately after the sacrifice (±SE; n = 8). (E) The protein levels of ATF3, GDF15, NDRG1, KAI-1, and β-actin of the tumors derived from the HT_shCOL and HT_shATF3 cells were determined by immunoblot assays. (F) The quantitative analysis was presented as the relative density of the target proteins/β-actin (±SE; n = 5). ∗, p < 0.05; ∗∗, p < 0.01.

    Journal: Biomedical Journal

    Article Title: Activating transcription factor 3 is an antitumor gene synergizing with growth differentiation factor 15 to modulate cell growth in human bladder cancer

    doi: 10.1016/j.bj.2024.100756

    Figure Lengend Snippet: Modulation of ATF3 on tumor growth of bladder cancer cells in xenograft model. (A) HT_shCOL and HT_shATF3 cells were injected subcutaneously in the dorsal area of the four-week-old male athymic nude mice (n = 8). Tumors derived from both cells were recorded after the mice were sacrificed. The tumor growth rates (B) and animal body weights (C) were measured within 24 days. (D) The tumor weights were recorded immediately after the sacrifice (±SE; n = 8). (E) The protein levels of ATF3, GDF15, NDRG1, KAI-1, and β-actin of the tumors derived from the HT_shCOL and HT_shATF3 cells were determined by immunoblot assays. (F) The quantitative analysis was presented as the relative density of the target proteins/β-actin (±SE; n = 5). ∗, p < 0.05; ∗∗, p < 0.01.

    Article Snippet: GDF15 and ATF3 shRNA lentiviral transduction particles (sc-39335-V and sc-29757-V) were purchased from Santa Cruz Biotechnology (CA, USA).

    Techniques: Injection, Derivative Assay, Western Blot

    Modulation of metformin on the expressions of ATF3 and GDF15 in the bladder cancer cells. The expressions of ATF3, GDF15, NDRG1, and β-actin in the T24 cells after being treated with or without 4 mM of metformin at normal glucose conditions (5 mM) were determined by immunoblot assays (A) and quantitative analysis (B). The expressions of ATF3 and GDF15 in the HT1376 cells after being treated with 5 mM or 30 mM glucose and with/without 4 mM of metformin, as indicated. were determined by immunoblot assays (C) and quantitative analysis (D). (E) Gene expressions of ATF3 and GDF15 in HT1376 cells after being treated with/without various dosages of metformin, as indicated, were determined by RT-qPCR. Protein expressions of ATF3 and GDF15 in HT1376 cells after being treated with/without metformin or SB431542, as indicated, were determined by immunoblot assays (F) and quantitative analysis (G). (H) Protein expressions of ATF3 and GDF15 in HT_shCOL and HT_shATF3 cells after being treated with/without metformin were determined by immunoblot assays (left) and quantitative analysis (right). Quantitative analysis data were expressed as the intensity of protein bands produced from the expressions of the target proteins/β-actin (±SE; n = 3) relative to the vehicle-treated group. ∗, p < 0.05; ∗∗, p < 0.01.

    Journal: Biomedical Journal

    Article Title: Activating transcription factor 3 is an antitumor gene synergizing with growth differentiation factor 15 to modulate cell growth in human bladder cancer

    doi: 10.1016/j.bj.2024.100756

    Figure Lengend Snippet: Modulation of metformin on the expressions of ATF3 and GDF15 in the bladder cancer cells. The expressions of ATF3, GDF15, NDRG1, and β-actin in the T24 cells after being treated with or without 4 mM of metformin at normal glucose conditions (5 mM) were determined by immunoblot assays (A) and quantitative analysis (B). The expressions of ATF3 and GDF15 in the HT1376 cells after being treated with 5 mM or 30 mM glucose and with/without 4 mM of metformin, as indicated. were determined by immunoblot assays (C) and quantitative analysis (D). (E) Gene expressions of ATF3 and GDF15 in HT1376 cells after being treated with/without various dosages of metformin, as indicated, were determined by RT-qPCR. Protein expressions of ATF3 and GDF15 in HT1376 cells after being treated with/without metformin or SB431542, as indicated, were determined by immunoblot assays (F) and quantitative analysis (G). (H) Protein expressions of ATF3 and GDF15 in HT_shCOL and HT_shATF3 cells after being treated with/without metformin were determined by immunoblot assays (left) and quantitative analysis (right). Quantitative analysis data were expressed as the intensity of protein bands produced from the expressions of the target proteins/β-actin (±SE; n = 3) relative to the vehicle-treated group. ∗, p < 0.05; ∗∗, p < 0.01.

    Article Snippet: GDF15 and ATF3 shRNA lentiviral transduction particles (sc-39335-V and sc-29757-V) were purchased from Santa Cruz Biotechnology (CA, USA).

    Techniques: Western Blot, Quantitative RT-PCR, Produced

    Co-modulation between ATF3 and GDF15 in the bladder cancer cells. The expressions of ATF3, GDF15, and β-actin in (A) T24-DNA, T24-GDF15, (B) HT_shCOL, and HT_shGDF15 cells were determined by immunoblot assays. Quantitative analysis data were expressed as the intensity of protein bands produced from the expressions of the target proteins/β-actin (±SE; n = 3) relative to the vehicle-treated group. The ratio of gene expressions of ATF3 and GDF15 in (C) T24-DNA, T24-GDF15, (D) HT_shCOL, HT_shGDF15, (E) T24-DNA, T24-ATF3, (F) HT_shCOL, and HT_shATF3 cells were determined by RT-qPCR. Data from quantitative analysis were expressed as the expressions of the target genes/β-actin relative to the mock-control group (±SE; n = 3). ∗, p < 0.05; ∗∗, p < 0.01.

    Journal: Biomedical Journal

    Article Title: Activating transcription factor 3 is an antitumor gene synergizing with growth differentiation factor 15 to modulate cell growth in human bladder cancer

    doi: 10.1016/j.bj.2024.100756

    Figure Lengend Snippet: Co-modulation between ATF3 and GDF15 in the bladder cancer cells. The expressions of ATF3, GDF15, and β-actin in (A) T24-DNA, T24-GDF15, (B) HT_shCOL, and HT_shGDF15 cells were determined by immunoblot assays. Quantitative analysis data were expressed as the intensity of protein bands produced from the expressions of the target proteins/β-actin (±SE; n = 3) relative to the vehicle-treated group. The ratio of gene expressions of ATF3 and GDF15 in (C) T24-DNA, T24-GDF15, (D) HT_shCOL, HT_shGDF15, (E) T24-DNA, T24-ATF3, (F) HT_shCOL, and HT_shATF3 cells were determined by RT-qPCR. Data from quantitative analysis were expressed as the expressions of the target genes/β-actin relative to the mock-control group (±SE; n = 3). ∗, p < 0.05; ∗∗, p < 0.01.

    Article Snippet: GDF15 and ATF3 shRNA lentiviral transduction particles (sc-39335-V and sc-29757-V) were purchased from Santa Cruz Biotechnology (CA, USA).

    Techniques: Western Blot, Produced, Quantitative RT-PCR, Control

    Figure 1. Expression of WISP1 in LSCC tissues. The mRNA (a) and protein (b) levels of WISP1 in normal mucosa and LSCC tissues were determined by qRT-PCR and Western blotting. The transcription (c) and protein (d) expression of WISP1 in LSCC with metastasis and without metastasis groups. *P < 0.05.

    Journal: Experimental biology and medicine (Maywood, N.J.)

    Article Title: WISP1 aggravates cell metastatic potential by abrogating TGF- β -Smad2/3-dependent epithelial-to-mesenchymal transition in laryngeal squamous cell carcinoma.

    doi: 10.1177/1535370221992703

    Figure Lengend Snippet: Figure 1. Expression of WISP1 in LSCC tissues. The mRNA (a) and protein (b) levels of WISP1 in normal mucosa and LSCC tissues were determined by qRT-PCR and Western blotting. The transcription (c) and protein (d) expression of WISP1 in LSCC with metastasis and without metastasis groups. *P < 0.05.

    Article Snippet: The specific siRNA targeting WISP1 (sc-39335), TGF-b (sc-270322) and the control scramble siRNA (si-NC) were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA).

    Techniques: Expressing, Quantitative RT-PCR, Western Blot

    Figure 3. Elevation of WISP1 facilitated EMT, whereas WISP1 depression yielded the opposite effects. (a) LSCC cells were infected with Ad-WISP1, and the expression of EMT markers E-cadherin and vimentin was analyzed. (b) Following knockdown of WISP1 by si-WISP1 transfection, the expression of E-cadherin and vimentin was measured. *P < 0.05.

    Journal: Experimental biology and medicine (Maywood, N.J.)

    Article Title: WISP1 aggravates cell metastatic potential by abrogating TGF- β -Smad2/3-dependent epithelial-to-mesenchymal transition in laryngeal squamous cell carcinoma.

    doi: 10.1177/1535370221992703

    Figure Lengend Snippet: Figure 3. Elevation of WISP1 facilitated EMT, whereas WISP1 depression yielded the opposite effects. (a) LSCC cells were infected with Ad-WISP1, and the expression of EMT markers E-cadherin and vimentin was analyzed. (b) Following knockdown of WISP1 by si-WISP1 transfection, the expression of E-cadherin and vimentin was measured. *P < 0.05.

    Article Snippet: The specific siRNA targeting WISP1 (sc-39335), TGF-b (sc-270322) and the control scramble siRNA (si-NC) were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA).

    Techniques: Infection, Expressing, Knockdown, Transfection

    Figure 2. WISP1 regulated cell invasion and migration in LSCC cells. (a) The LSCC cell line TU212 was infected with Ad-WISP1, and the protein levels of WISP1 were measured. (b) After overexpression of WISP1 in LSCC cells, the effects on cell invasion were evaluated by transwell assay. (c) Effects of WISP1 elevation on cell migration. (d) Cells were transfected with si-WISP1, then the expression of WISP1 was assessed. (e) Effects of WISP1 knockdown on cell invasion. (f) Transwell assay was performed to detect cell migration. *P < 0.05. (A color version of this figure is available in the online journal.)

    Journal: Experimental biology and medicine (Maywood, N.J.)

    Article Title: WISP1 aggravates cell metastatic potential by abrogating TGF- β -Smad2/3-dependent epithelial-to-mesenchymal transition in laryngeal squamous cell carcinoma.

    doi: 10.1177/1535370221992703

    Figure Lengend Snippet: Figure 2. WISP1 regulated cell invasion and migration in LSCC cells. (a) The LSCC cell line TU212 was infected with Ad-WISP1, and the protein levels of WISP1 were measured. (b) After overexpression of WISP1 in LSCC cells, the effects on cell invasion were evaluated by transwell assay. (c) Effects of WISP1 elevation on cell migration. (d) Cells were transfected with si-WISP1, then the expression of WISP1 was assessed. (e) Effects of WISP1 knockdown on cell invasion. (f) Transwell assay was performed to detect cell migration. *P < 0.05. (A color version of this figure is available in the online journal.)

    Article Snippet: The specific siRNA targeting WISP1 (sc-39335), TGF-b (sc-270322) and the control scramble siRNA (si-NC) were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA).

    Techniques: Migration, Infection, Over Expression, Transwell Assay, Transfection, Expressing, Knockdown

    Figure 4. Effects of WISP1 expression on TGF-b-Smad signaling in LSCC cells. (a) TU212 cells were transfected with WISP1 vectors or si-WISP1, then the protein levels of TGF-b, p-Smad2, Smad2, p-Smad3, and Smad3 were analyzed by Western blotting. (b–d) The quantified analysis on binding bands was evaluated by Image J software. *P < 0.05.

    Journal: Experimental biology and medicine (Maywood, N.J.)

    Article Title: WISP1 aggravates cell metastatic potential by abrogating TGF- β -Smad2/3-dependent epithelial-to-mesenchymal transition in laryngeal squamous cell carcinoma.

    doi: 10.1177/1535370221992703

    Figure Lengend Snippet: Figure 4. Effects of WISP1 expression on TGF-b-Smad signaling in LSCC cells. (a) TU212 cells were transfected with WISP1 vectors or si-WISP1, then the protein levels of TGF-b, p-Smad2, Smad2, p-Smad3, and Smad3 were analyzed by Western blotting. (b–d) The quantified analysis on binding bands was evaluated by Image J software. *P < 0.05.

    Article Snippet: The specific siRNA targeting WISP1 (sc-39335), TGF-b (sc-270322) and the control scramble siRNA (si-NC) were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA).

    Techniques: Expressing, Transfection, Western Blot, Binding Assay, Software

    Figure 6. Abrogating the TGF-b-Smad pathway reversed the effects of WISP1 on EMT and pro-metastatic potential of LSCC cells. (a) TU212 cells were transfected with si-TGF-b, then the expression of TGF-b protein was detected. The corresponding quantified analysis was carried out based on Western blot. (b) The expression of p-Smad2, Smad2, p-Smad3, Smad3 was determined after TGF-b knockdown by Western blotting. The corresponding quantified analysis was carried out based on Western blot. (c) After blockage of TGF-b signaling by si-TGF-b transfection, the effects on EMT markers E-cadherin and vimentin were measured using Western blot. The consequents on cell invasion (d) and migration (e) were analyzed. *P < 0.05 vs. control groups; #P < 0.05 vs. WISP1-overexpressed groups. (A color version of this figure is available in the online journal.)

    Journal: Experimental biology and medicine (Maywood, N.J.)

    Article Title: WISP1 aggravates cell metastatic potential by abrogating TGF- β -Smad2/3-dependent epithelial-to-mesenchymal transition in laryngeal squamous cell carcinoma.

    doi: 10.1177/1535370221992703

    Figure Lengend Snippet: Figure 6. Abrogating the TGF-b-Smad pathway reversed the effects of WISP1 on EMT and pro-metastatic potential of LSCC cells. (a) TU212 cells were transfected with si-TGF-b, then the expression of TGF-b protein was detected. The corresponding quantified analysis was carried out based on Western blot. (b) The expression of p-Smad2, Smad2, p-Smad3, Smad3 was determined after TGF-b knockdown by Western blotting. The corresponding quantified analysis was carried out based on Western blot. (c) After blockage of TGF-b signaling by si-TGF-b transfection, the effects on EMT markers E-cadherin and vimentin were measured using Western blot. The consequents on cell invasion (d) and migration (e) were analyzed. *P < 0.05 vs. control groups; #P < 0.05 vs. WISP1-overexpressed groups. (A color version of this figure is available in the online journal.)

    Article Snippet: The specific siRNA targeting WISP1 (sc-39335), TGF-b (sc-270322) and the control scramble siRNA (si-NC) were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA).

    Techniques: Transfection, Expressing, Western Blot, Knockdown, Migration, Control